knockout


Also found in: Dictionary, Thesaurus, Medical, Legal, Financial, Encyclopedia, Wikipedia.

knock out

1. verb To cause something to fall out of something else by striking or colliding with it, either intentionally or unintentionally. In this usage, a noun or pronoun can be used between "knock" and "out." I tried to knock out the broken piece, but it seems like it's stuck in there. When Dave crashed his bike, he knocked the mail out of the mailbox. It was actually kind of funny.
2. verb To render one unconscious, as from a physical blow or a drug. In this usage, a noun or pronoun can be used between "knock" and "out." You really think you can knock out the champ? We're going to knock you out for this procedure, so you won't feel any pain at all.
3. verb To exhaust one or make one fatigued. In this usage, a noun or pronoun is used between "knock" and "out." It's amazing how standing all day can really knock you out. My medication usually knocks me out, so I better stay home for the day.
4. verb, slang To thoroughly impress, overwhelm, or excite one. In this usage, a noun or pronoun is used between "knock" and "out." The show of support from everyone just knocked me out. That movie really knocked me out—I didn't expect it to be so good!
5. verb, slang To cause to stop operating or functioning. In this usage, a noun or pronoun can be used between "knock" and "out." The storm knocked out power to the whole island. Be careful not to overload the system—you could knock it out with too much traffic.
6. verb, slang To eliminate from contention, as in a sports competition. In this usage, a noun or pronoun can be used between "knock" and "out." Every year, some underdog knocks out a top-seeded team. I'd love to knock the defending champs out of the tourney, but it will take a miracle.
7. verb, slang To produce or complete something, usually with the main motivation of simply getting it done. If we can knock out a few more of these reports before the weekend, we'll be in good shape for next week. I'm just trying to knock out as many pages as possible so I can get up to the page count before the deadline.
8. noun In boxing and similar sports, a blow that renders one unconscious or technically disqualifies one from continuing, or the result of a match in which such a blow has occurred. In this usage, the phrase is usually hyphenated or spelled as one word. That was a vicious knockout by the newcomer. His record is 10-0, with eight knockouts.
9. noun An elimination from contention, as in a sports competition. In this usage, the phrase is usually hyphenated or spelled as one word. I can't believe there were six knockouts in the first round!
10. noun, slang A great success. In this usage, the phrase is usually spelled as one word. I think this release is going to be a real knockout. Great job, everyone!
11. noun, slang A beautiful person, typically a woman. In this usage, the phrase is usually spelled as one word. Remember Paula from high school? Well, she's a knockout know, and she's dating Mike Miller!
See also: knock, out

knock someone out

 
1. Lit. to knock someone unconscious. (Someone includes oneself.) Fred knocked Mike out and left him there in the gutter. Fred knocked out Mike.
2. Fig. to make someone unconsciousness. The drug knocked her out quickly. The powerful medicine knocked out the patient.
3. Fig. to surprise or please someone. I have some news that will really knock you out.
4. Fig. to wear someone out; to exhaust someone. All that exercise really knocked me out. The day's activities knocked the kids out and they went right to bed.
See also: knock, out

knock something out

 
1. to create something hastily. He knocked a few out as samples. He knocked out a few of them quickly, just so we could see what they were going to look like.
2. Fig. to put something out of order; to make something inoperable. The storm knocked the telephone system out. The high winds will probably knock out electrical service all over town.
See also: knock, out

knock out

1. Also, knock out cold. Render unconscious by a blow or some other means. For example, It was just a swinging door, but it knocked her out, or Just one of those sleeping pills can knock you out cold. [Late 1500s]
2. Make tired, exhaust, as in That sightseeing tour knocked me out.
3. Render useless or inoperative, as in The storm knocked out the power.
4. See knock off, def. 2.
See also: knock, out

knock out

v.
1. To hit something abruptly and cause it to move beyond a border: The batter knocked the baseball out of the stadium. I removed the filter and knocked out the dust.
2. To cause someone to be eliminated from some competition: An engine malfunction knocked the car out of the race. We knocked out last year's champions in the quarterfinals.
3. To render someone unconscious: The thief knocked the guards out before they could call for help. Those sleeping pills could knock out a horse! I banged my head on the car door and knocked myself out.
4. To defeat someone in boxing with a punch from which he or she cannot recover: The new champion has knocked out the last three opponents. The boxer knocked the opponent out in the first round.
5. To render something useless, inoperative, or ineffective: The storm knocked the phone lines out across the state. High winds knocked out the power to all the homes in the valley.
6. To exert or exhaust someone thoroughly in order to accomplish something. Used reflexively: She always knocks herself out to be ready on time. Try to clean the house for the party, but don't knock yourself out.
7. To produce something in abundance: The workers knocked out 500 parts in an hour. We used to make the parts by hand, but the machine can knock them out much faster.
8. Slang To impress someone greatly: Your new poems knock me out!
See also: knock, out

knockout

1. n. something that is quite stunning. Your new car is a knockout.
2. n. a good-looking man or woman. Your date is a real knockout.
3. mod. very exciting. It was a real knockout evening.
References in periodicals archive ?
Gonzalez had a 21-1, win-loss record but with only eight knockouts, compared to Ancajas's distinctly impressive 28-1-1, with 19 knockouts.
To identify colonies with bi- and mono-allelic mutations, an internal PCR was performed using 100 ng genomic DNA, primers (primer E: GCCACCC TCCAGTGGCAAAAGCGAAGACAG; primer F: TCATCGAAGGAGCCCGTGTCGGACTCCATG) against a part of exon 3 that was excluded from the knockout vector, and KOD FX Neo Polymerase (TOYOBO Co.
Here, the local newspapers were forums of direct and indirect opposition to the Knockout.
Friday: Echo Knockout (third round): St Helens v Firwood Bootle, Sefton Park v Formby.
One is a knock-out-bar-disconnect system that uses spring-loaded knockout bars.
As a leading provider of genetically engineered knockout mice, TIGM provides an essential resource to scientists all over the world.
Belfry (Liam King, Paul Folkard) drew their under-13s Knockout Cup final with Belle Vale FC 2-2 before claiming the trophy 3-2 on penalties, Aiden Sentell hit three in Burford's 6-1 Valley Shield quarter-final win over Blackbrook Juniors, and Swanside Boys (Zac Roberts, Kieran Sprung, Jonathan Bell, Rob McClintock) played out an entertaining 4-4 draw with Netherley WLL (Scott Dunning 2, Joe Peers, Joe Berquest).
Accordingly, in collaboration with the National Institute of Radiological Sciences (NIRS), TransGenic will analyze gene expressions in embryonic stem (ES) cells of gene knockout mice.
The mood problems of these knockout mice were unexpected, Gingrich says, because when SSRIs inactivate the serotonin transporter in normal, mature mice, they ease depression symptoms, as they do in people.
So knockout mice reap some of the benefits of gene expression whereas hypothyroidal mice don't.
locating ring; the ejector-hlaf ear plate has a standard knockout hole pattern (special patterns are available on request).
More than 200,000 C57BL/6 Knockout Mouse Embryonic Stem Cell Clones Now Available to Supply Researchers with Knockout Mice
Memories of that six wicket victory - the Premier Division Knockout final last year - will come flooding back for Neil Rimmer and his side when they take on Bootle once more on Sunday.
He's coming off a 10th-round knockout of Jhonny Gonzalez last September.
The scientists hypothesized that these two types of so-called knockout mice would develop epilepsy more slowly than normal mice do.